Anschläge aufs Weihnachtsfest gehen unvermindert weiter

71

21. Dezember 2013 von UBasser


 

Die gezielten Anschläge auf unser traditionelles Weihnachtsfest und alles was damit zu tun hat, gehen aus der hiesigen Gutmenschenmafia ungehindert weiter. So auch in Stuttgart, wo die althergebrachte Weihnachtsfeier am Gottlieb-Daimler-Gymnasium nun kurzerhand frech in „Multikulturelle Feier zum Fest der Werte“ umbenannt wurde.

In der selbstgewählten Anbiederungsorgie der Schule wollten die Verantwortlichen mit dem Multi-Kulti-Fest würdigen, daß an dem Gymnasium 23 Nationalitäten vertreten seien, worunter sich natürlich auch viele Nicht-Christen befinden. Wie auch in anderen Orten der bunten Republik Deutschland halten es die Antideutschen deshalb für geboten, aufgrund massiver Überfremdungszahlen sich kulturfremden Ausländer auf die schleimigste Weise anzudienen.

Nachdem sich Bürgerinnen und Bürger über den gutmenschlichen Mist der Umbenennung im Internet Luft entsprechend machten, bildete sich die Schulleitung sogar ein Bedrohungsszenario ein und die antideutsche Schülerfeier wurde aus Sicherheitsgründen ins Gottlieb-Daimler-Gymnasium selbst verlegt.

Die traditionszerstörende Blödel-Party verlief dann aber nach Angaben der Veranstalter ohne etwaige Störungen. Selbst der gutmenschliche grüne Stuttgarter Oberbürgermeister Fritz Kuhn mußte zu der Multi-Kulti-Posse eine Beitrag absondern und sicherte dem Gymnasium die Solidarität der Stadt zu, ganz so, als hätte es einen Amoklauf oder ein Schulmassaker an der Bildungseinrichtung zuvor gegeben.

Quelle: Der Dritte Weg

..

Ubasser

71 Kommentare zu “Anschläge aufs Weihnachtsfest gehen unvermindert weiter

  1. Roland sagt:

    @Deutscher

    Du glaubst doch sicher auch an Einstein? Dann kann es die Evolution aus Zeitmangel schon gar nicht gegeben haben. Weil nach Einstein die Erde noch gar nicht älter als 1 Jahr sein kann. Dieses Maximalalter der Erde wurde sogar mit Lichtgeschwindigkeit und einem Stein gemessen!

    • Roland sagt:

      @“Deutscher“

      Du verstehst anscheinend nicht einmal eine Aussage. Ich sagte doch, woher das kommt: Einstein

      Einstein hat sich zur gravitativ bedingten Zeitdilatation ausgelassen und dazu einige Formeln bekannt gegeben und zudem sein 2. Postulat aufgestellt. Und Steine liegen überall herum und damit kann man die Erdbeschleunigung mit g = 9,81 m/s² feststellen.

      Und Einstein sagt, die Lichtgeschwindigkeit c ist konstant und soundsoviel groß und das maximale Erdalter ergibt sich dann am Ende zu tmax = c/g

      Einsetzen der Werte ergibt dann ein tmax = 30,55e6 s und das sind 0,968 Jahre.

      Da die Sonne nach Einstein höchstens 12,66 Tage alt sein kann und logischerweise die Erde wohl jünger als die Sonne sein muß, kann auch die Erde nur 12,66 Tage alt sein.

      Deshalb kann es die Evolution gar nicht gegeben haben und wenn man deine gedankliche Leistung sich ansieht, stellt man nur Degeneration fest. Da ziehst du mit Einstein gleich.

  2. Roland sagt:

    Ein und dieselbe Botschaft in verschiedenen Codierungen:

    Binär (2 Zeichen):
    001000110010111010011000001010100010110111111101100110111010111001011110010111111011011101
    111001110100111101001100110111001011111001110010111111011011101100000100110111101001101001
    110011011100001101110111110011001011100000100110111111101101110110000010100101100010110100
    111101001101110110000010111000100110110010011101011101000111001011111001110100110111011000
    001010000110011011001101110100110100111111001101001110110111111110100101111010011000001011
    100010011011100001110101110100011101001101110111100111110011100101110010011010011111010111
    0100111000010

    DNA (4 Zeichen):
    AGATAGTGGCGAAGGGAGTCTTTCGCGTGGTGCCTGCCTTGTCTCTGCTCATTCATATCTAGTTGCTAGTTTCGTGTAACATCTGGCGGC
    TATCTAATCTCTTATAGTGAAGCGTTTGTCTCGAAGGCCGAGTCATTCATCTCGAAGTGAGCGTAGCTCCTCACTAGTTGCTCATCTCGA
    AGGACGCGTATCTCATCATTTATCATGTCTTTGGCCTGGCGAAGTGAGCGTGACTCCTCACTCATCTCTGCTTATGCCTAGCGGCTTCCT
    CATGAC

    Oktal (8 Zeichen):
    106272301242677546727136277335716475146713716277335404675151633415676313404677556602454264
    751566027046623535071371646730120633156464771516677645723013423341656435156747634562323727
    2341

    Dezimal (10 Zeichen):
    177583281551232787237512359103398327751157512359255833927675911523255123592751139835921132
    7198735751158359267272783391153955125238321132767873583591031032319391078366

    Hexadezimal (16 Zeichen)
    232E982A2DFD9BAE5E5FB779D3D3372F9CBF6EC137A69CDC377CCB826FEDD82962D3D3760B89B275D1CBE74DD8
    2866CDD34FCD3B7FA5E982E26E1D7474DDE7CE5C9A7D74E1

    Alphabet (100 Zeichen):
    Die Evolutionsreligion verlangt von ihren Gläubigen allergrößte Glaubensstärke!

    ———————–
    Zufällige Entstehungswahrscheinlichkeit = 10^( -166 )

    • Roland sagt:

      @“Deutscher“
      Zusammen mit Groß- und Kleinschreibung samt Satzzeichen und Sonderzeichen müssen wir bei jedem Tastendruck eine von rund 100 Möglichkeiten auswählen.

      Das Wort „Gaskammertemperatur“ würde eine Affenherde mit Schreibmaschine oder ein zufallsbuchstabenerzeugender Superrechner daher niemals zufällig erfinden können.

      Weil diese Ziffernfolge „Gaskammertemperatur“ bereits eine zufällige Entstehungswahrscheinlichkeit von 10^(-38) hat und 1000000 mit 1000 GHz taktende Rechner erst nach Billionen Jahren so eine sinnvolle Buchstabenkombination gefunden hätten.

      • Roland sagt:

        @“Deutscher“

        Aber Ziffern, Satz- und Sonderzeichen gehören zu einer schriftlich dargestellten Sprache und Deine Dummheit ist wirklich bemerkenswert, da du selbst damit das Argument der totalen Unwahrscheinlichkeit nicht entkräften kannst! Alle mit den verschiedenen Codes dargestellte Information haben dieselbe Bildungswahrscheinlichkeit, weil sie dieselbe Informationsmenge beinhalten. Beim Menschen ist die zufällige Bildungswahrscheinlichkeit der DNA-Information etwa 10^(-1,8 Mrd.).

      • Roland sagt:

        @“Deutscher“

        Schöpfungswahrscheinlichkeit = Lebenswahrscheinlichkeit – Wahrscheinlichkeit einer zufälligen Lebensentstehung

        Die Wahrscheinlichkeit einer zufälligen Lebensentstehung ist 0. Die Lebenswahrscheinlichkeit ist 1, weil es Leben gibt. Daher gilt

        Schöpfungswahrscheinlichkeit = 1 – 0 = Eins

      • Skeptiker sagt:

        @Alle

        Wenn Ihr mein Harald 9000 das Passwort richtig vorsagt, beantwortet er Euch alle Fragen.

        Es sind doch bloß 4 Zahlen.

        2001: Odyssee im Weltraum

        Gruß Skeptiker

      • Kint sagt:

        Skeptiker, das ist ein Hammer, am richtigen Platz – und ich schätze, damit hast Du den Nagel diesmal sogar DURCH den Kopf getroffen!

  3. Roland sagt:

    Also, wenn jemand eine Begründung geben müßte dann doch DU, der den Blödsinnsgehalt der Evolutionsreligion verteidigt!

    Wo sind deine Beweise, welche dich zu der Annahme verleiten, daß sich 1000000000000 bändige Bücher fehlerfrei und verständlich von selbst schreiben können, wenn man der „Natur“ nur genügend Buchstaben hinlegt?

    Die „Evolution“ hätte in der zur Verfügung stehenden Zeit von einigen Sextilliarden Jahren oder meinetwegen sogar in 6000 Jahren nicht einmal einen ähnlich sinnvollen Text wie diesen hier schreiben können!

    Deshalb weiß jeder denkfähige Mensch, daß das Leben von einer allerhöchsten Intelligenz geschaffen wurde. Eine zufällige Entwicklung fand niemals statt.

    • Roland sagt:

      @“Deutscher“

      „Die Evolution ist nicht zielgerichtet, von daher ist das Argument mit dem Zufall nicht stichhaltig.“

      Natürlich ist die Evolution nicht zielgerichtet. Und aus diesem Grund gab es sie auch nicht! Nur eine Evolution, deren Ziel es ist, ein funktionsfähige Maschine zu produzieren, hätte Erfolg haben können. Allerdings setzt dies eine Intelligenz voraus. Und die besitzt deine Evolutionsreligion nicht.

      „Das wäre ungefähr genauso als würde man behaupten es ist unmöglich das jemals im Lotto gewonnen wird, weil die Wahrscheinlichkeit für 6 Richtige so verschwindend gering ist.“

      Nein, das ist nicht miteinander vergleichbar. Da mußt du schon sagen, daß eine Person in Folge wenigstens 300 000 mal 6 Richtige gewonnen hat. Dann hat er ungefähr den Bauplan eines Bakteriums sich erlottert.

      „Wo ist denn dein Beweis für die allerhöchste Intelligenz?“

      Dieser Text ist bereits der Beweis! Die zufällige Entstehungswahrscheinlichkeit dieses funktionierenden (einziges Kriterium!) Textes liegt bei ca. 10^(-2000).

      • Roland sagt:

        Du hast das Prinzip nicht verstanden. Erst einmal muß der Bauplan eines Bakteriums rein zufällig erfunden worden sein. Dazu ist Bedingung, daß er richtig ist, also funktionieren kann. Nehmen wir einmal an, es gibt 10^10000 funktionierende Bakterienbaupläne und jeder dieser funktionierenden Baupläne hat eine Länge von 4 MB, was einer Dezimalzahllänge mit 2,4 Millionen Dezimalziffern bedeutet.

        Damit ist die Wahrscheinlichkeit, daß ein einziger funktionierender Bauplan von den 10^10000 möglichen funktionierenden Bauplänen gefunden wird,

        10^( – 2 400 000 + 10000 ) = 10^( – 2 239 000).

        Erst muß einmal ein funktionierendes Bakterium entstanden sein! Das ist das Problem!

        Nun lassen wir einmal von einem Superrechner zufällige Bakteriencodes der Länge „2 400 000“ Dezimalziffern ausspucken. Das machen wir mit Parallelrechnern. Dazu nehmen wir an, daß das gesamte uns bekannte Universum aus Rechnern besteht, jedes Atömchen ist ein Superrechner. Und diese atomaren Superrechner takten mit Lichtfrequenz von 10^15 Hz und jeder einzelne Rechner spuckt je Takt einen Bakteriencode aus.

        Dann haben wir 10^80 Rechner und je Sekunde werden 10^(80 + 15 ) = 10^95 Codes erzeugt.

        Das Jahr hat ungefähr 10^8 Sekunden und wir lassen alle Rechner erst einmal 10^100 Jahre arbeiten. Dann wurden 10^( 95 + 8 + 100) = 10^203 Code erzeugt.

        Die Wahrscheinlichkeit, daß ein einziger funktionierender Code der 10^10000 möglichen funktionierenden Code gefunden wurde, beträgt dann
        10^( – 2 400 000 + 10000 + 203 ) = 10^( – 2 389 792 ).

        Dies ist eine Nullwahrscheinlichkeit.

        Die Schöpfungswahrscheinlichkeit ist Lebenswahrscheinlichkeit minus Zufallswahrscheinlichkeit. Die Lebenswahrscheinlichkeit ist hierbei 1, da wir schließlich leben. Daher kann man für dieses Beispiel sagen:

        Schöpfungswahrscheinlichkeit = 1 – 10^( – 2 389 792 ) = 1

        Bei diesem Beispiel habe ich nicht nur 10^10 Jahre Ausprobiererei unterstellt sondern etwas mehr und auch meine Versuchsgeschwindigkeit habe ich etwas erhöht gehabt!

      • Roland sagt:

        @“Deutscher“

        300000 Lottosechser haben eine Haupttrefferwahrscheinlichkeit von ca. 1:14 Mio für jeden Haupttreffer. 14000000 sind gerundet 10^7, entsprechen also einer 7-stelligen Dezimalzahl.

        300 000 * 7 ist ca. 2,1 Mio Dezimalziffern und dies korrespondiert abgerundet mit den 2,4 Mio Dezimalziffern des Bakteriencode!

        Bei den Bakterien kommt übrigens ein anderer göttlicher Trick zum Vorschein, weil sie eine besondere Aufgabe haben. Sie können sich tatsächlich „evolutionieren“. Aber es gibt eine Grenze, welche ein Bakterium beim evolutionieren nicht überschreiten kann. Es wird daher immer ein Bakterium bleiben. Die Besonderheit beim Bakterium ist die asexuelle Fortpflanzung, welche echte Klone in vielfältiger Anzahl erzeugt. Wenn überlebensfähige Mutationen vorkommen, etwa durch radioaktive Bestrahlung, können sich auch diese Mutationen verfielfältigen und daraus kann wiederum sich etwas Neues bilden. Daher können sich Bakterien anpassen und z.B. Öl auffressen.

        Jedes beliebige Bakterium kann sich nach einiger Zeit zum Ölfresser entwickeln.

        Aber diese Eigenschaft geht sofort verloren, wenn die asexuelle Fortpflanzung verlassen wird. Das geht bereits nicht mehr. Das Bakterium bleibt daher immer ein Bakterium.

        Bei Lebewesen, welche sich sexuell fortpflanzen, gibt es keinerlei Anpassungsmöglichkeiten mehr. Nur die, welche von Anfang an im Bauplan vorgesehen waren. Dann werden einige Subroutinen aktiviert und das Lebewesen kann sich innerhalb dieses vorgesehenen Rahmens an die Umwelt anpassen. Das geht sogar sehr schnell.

        Bisher hat es übrigens noch keine 10^62 unterschiedliche Bakterien gegeben.

      • Roland sagt:

        @“Deutscher“
        „Ich nehme an du hast dazu wissenschaftliche Arbeiten die das belegen oder träumst du das Nachts einfach nur?“

        Nachts schlafe ich nur und du hast bereits gezeigt, daß du nicht einmal einfachste wissenschaftliche Argumentation und Beweisführung verstehst.

        „Ansonsten musst du dich leider damit abfinden das dein Wissenstand bezüglich der Evolution also mit Sicherheit älter als 150 Jahre ist.“

        Ich beschäftige mich nicht weiter mit sofort erkennbarem Unsinn wie die „Evolution“ und daher ist das Alter meines Wissensstandes unerheblich. Die „genaue“ Erforschung dieses Unsinns überlasse ich gerne den Dummen.

        „Da muss man sich schon ernsthaft fragen wieso diese allerhöchste Inteligenz so dumme Menschen erschaffen hat?!“

        Wenn alle gleich wären, gäbe es wohl nur Mord und Totschlag und deshalb sind die Menschen unterschiedlich.

        Jede Arbeit muß schließlich gemacht werden und wenn ich mir einen Kaffee mache, habe ich manchmal nur heißes Zuckerwasser in der Tasse. Deshalb habe ich ein Hausmädchen, die das viel besser als ich kann und dabei sogar glücklich ist.

        Oben ist mir ein Tippverwechsler unterlaufen. Es gab bisher weniger als 1e47 Bakterien.

      • Kint sagt:

        Armer Roland. Kannst soviel rechnen wie Du willst. Kannst drauf hinweisen, dass nie solch eine Mutation beobachtet wurde. Kannst auf die rechnerische Unwahrscheinlichkeit hinweisen, was bedeutet, dass die sog. „Theorie“ keine ist, sondern schon als Arbeitshypothese unbrauchbar ist.

        Nur eine Mutation musst Du hinnehmen: Dass Godwin´s Gesetz hier „Dummheit“ heißt.
        🙂

      • Enrico, Pauser sagt:

        @Deutscher —>alias „draco12“

        …was bezweckst du hier auf dem Blog???….glaubst du wirklich, daß dein Konzept der Verwirrung und Spaltung aufgeht???
        —-> mich kotzen diese ganzen pervers/selbstsüchtigen Emporstellungen seiner Selbst, nur noch an!!! —–> Können wir nicht ENDLICH mal ALLe an EINEM Strang ziehen???

      • Kint sagt:

        Ja, man wirft über Bord, und tritt mit Füßen. Aber erst seitdem man ne spektulative – also nicht ausreichende – Theorie zur offenkundigen Gewissheit erhoben hat. Und alle als dumm beschimpft, die das nicht einfach glauben.
        Und rechnen kannst auch Du solange Du willst. In der Zeit, in der Mutationen längst hätten erfolgen und beobachtet werden müssen – sind erfolgt? Keine – keine einzige, die Du beweisen kannst. Obwohl Du dafür nicht rechnen, sondern bloß zu zählen bräuchtest. Wie bedauerlich, dass Du da nicht über Null hinauskommst. Was nützt dir da, was interessiert mich die angebliche Berechnung, dass es angeblich anders sein müsste als es nun mal ist?
        Mit Deinen Rechnungen kannst du also gar nichts beweisen, nicht mal, dass sie richtig sind. Mit Deinem Feuereifer-Glauben beweist Du nur, dass Du hier Godwins Gesetz predigst.
        Wie schon gesagt: Das Totschlag-Argument heißt hier eben „Dummheit“.

      • Enrico, Pauser sagt:

        @Deutscher
        muß mich kurz fassen, hatte schon 3 mal nen Satement abgegeben, welches kurz vorm absenden, im Orkus des WeltWeitenWebs kassiert wurde 😦

        ….für mich gibt es seit 1998 kein rechts/links/oben/unten oder sonstigen POlitischen Scheiß mehr, daher kann ich von mir sagen, ich bin befreit von dieser GLOBALSCHEIßE!!!

        Wenn ich etwas in ALL den Jahren gelernt habe dann—-daß ich „MIR ALLeine“ (Familie und „engsten Freundeskreis“ inbegriffen) vertauen kann—–restliche „deutsch-Biomasse“, kann…NEIN, muß mir einfach am Arsch vorbei gehen, wenn ich überleben will!!!

        Ich trage das Blut der ATLANTER in mir ( 0 res.neg.)—-> ICH werde überleben, ob es hier oder auf anderen Blogs Leuten gefällt oder nicht, es wird so sein!!!

        …auch wenn ich nicht immer deiner Meinung bin, so wünsche ich dir trotzdem nen gutem Übergang ins entscheidende Jahr 2014 😉

      • Kint sagt:

        Du bist ein Masochist und genießt es, hier beleidigt zu werden, sagst Du – OK. Schließ nicht von Dir auf andere, glaub nicht, dass mir das ewige Geschwätz „Spaß“ macht. Finde es meist öde, deshalb steck ich meine Nase auch nur gelegentlich in Deine „Diskussionen“.
        Kannst Du eigentlich nur so krumm denken wie Du schreibst? Nichts für ungut, aber da mache ich aus meinem Herzen keine Mördergrube, wenn Du hier mit Dummheit und Intelligenz um Dich wirfst wie ein Äffchen mit Bananen. Zahlen als Ersatz für die Wirklichkeit, wie Du sie gern hättest – ganz famos. Evolution wäre die Entwicklung, Veränderung, Mutierung aus einem zum anderen. Albinos sind doch auch Mutationen, sagst Du, in Punkto Evolution mit dem Rücken zur Wand? Nein, nein, sagst Du jetzt, hab ich nie als Argument für die Evolution gemeint, ne weiße Giraffe ist natürlich keine Erklärung dafür, dass es überhaupt Giraffen gibt. Tolle Einsicht, mein Bester: Birnen sind kein Beweis für Äpfel. Wie weit hat uns das gebracht, was ist und bleibt der kleinste gemeinsame Nenner? Deine Zählung ist und bleibt bei Null. Also was soll das Gequatsche, welche Farbe Du für die Lackierung nehmen sollst, wenn Dich einer gebeten hat, ein Auto zu bauen? Sag ihm einfach, dass Du´s nicht kannst. Fertig.
        Du kannst nun mal nichts greifbares für Deinen Glauben anführen. Und daraus schließt der Mann mit dem Äpfel-Birnen-Kompott natürlich messerscharf, dass ausgerechnet! andere Auffassungen falsch oder widerlegt sind. Mit meiner ist´s nicht weit her – das spricht gegen die andere. Dunkel war´s, der Mond schien helle.
        Rechne doch auch die anderen mal nach… und erklär dann – zum Beispiel – die ewige Wiederkehr zum Beispiel der Zahl des goldenen Schnittes in allen Lebens- und kosmischen Bereichen (und seltsamerweise sogar in Bauwerken seit Urzeiten). Blanker Zufall, sagt der eifrige Rechner dann. Als Kind hat er – hoffentlich – gelernt, Zusammenhänge, Gleichartigkeiten zu erkennen, und seine Neugier treibt ihn dazu, sie zu erklären. Die beständige Wiederkehr spricht ja nicht gerade für einen Zufall… Mir doch egal, ein Beweis ist das nicht, sagt der skeptische Rechner. Warum sollte ich nach einem Zusammenhang suchen, Neugier ist was für Dumme. Wenn einer meint, er hätte einen gefunden, oder das auch nur „vielleicht…“ , sagt er: Quatsch, das kommt dabei raus, wenn Dumme am Werk sind, bloß Theorie, Spekulation, glaub ich nicht. Was er meint, ist: Damit beschäftige ich mich nicht. Typisch: Nie davon gehört – Quatsch. Lieber glauben, und möglichst laut predigen, was man selbst nicht verstanden hat. Kommt nur mir das so vor wie das Pfeifen im Walde?
        Nimm Dich doch wenigstens selbst mal ernst und denk nach. Und vergiss dann das Zählen nicht. Und schon bist Du über Null hinaus.
        War übrigens überhaupt nicht böse gemeint, dies nur nebenher. Wünsche Dir wie allen anderen nen guten Rutsch und ein gutes neues Jahr.

      • Frank sagt:

        @Deutscher

        Zur Evolutionstheorie:
        „In den Protokollen der Weisen von Zion werden Darwins Lehren als „Erfolg“ gewertet und als „zersetzend“ für die Nichtjuden bezeichnet.“

        Bist Du Jude ?

        http://www.evolutionsschwindel.com/

      • Frank sagt:

        @Deutscher

        Fragen beantworten und Logik scheint nicht Dein „Ding“ zu sein.
        Jedoch Haarspalterei auch Rabulistik genannt, wenn auch auf niedrigem Niveau

        „Was ist also deine Schlussfolgerung daraus?“

        Die Evolutionstheorie ist eine Erfindung der Juden mit dem Zweck der Spaltung, Verwirrung und Zerstörung.

        Zweite Schlussfolgerung.: Du bist mosaischen Glaubens

      • Kint sagt:

        Deutscher, – und nun tut´s mir wirklich nicht mehr leid, ist aber immer noch nicht böse gemeint – , Du outest Dich ja wirklich als willentlicher Idiot, was nun auch jedem Halbpfosten klar wie Kloßbrühe ist.
        Da mach ich Dich noch vorsorglich! drauf aufmerksam, dass es einen Unterschied zwischen Varianten und der Entstehung einer Art gibt, damit Du Dich nicht schon wieder und gleich das nächstemal verirrst. Und Du schreist mit Begeisterung Hurra und klappst die „Falle“, die ich, nur wegen Deiner Beschränktheit, schon vorsichtshalber zugeklappt habe, wieder auf und springst hinein. Albinos bestätigen, dass Darwin das Beste ist, was Deine Existenz erklärt. Wärst Du nicht auf Albinos gekommen, täten es natürlich auch unterschiedliche Haarfarben oder Fingerabdrücke. Alles andere bleibt natürlich unbeantwortet, wegen der Dummheit wahrscheinlich.
        Und natürlich erweist Du Dich damit als begnadeter Steller und Aufdecker von Fallen.
        Langsam begreif ich erst selbst, warum ich noch lese, noch antworte.
        Es ist nicht Masochismus, wie angeblich bei Dir. Es ist die Faszination mitzuerleben, wie einer mit wahrer Wonne alle Realität und Rationalität verdrängt und sich mit derselben Wonne im Irrsinn badet. Und es genießt, dass kein Argument, kein Fakt ihn erreichen kann, weil es an ihm abprallt. Mit wachsender Begeisterung. Der schiere Genuss des eigenen, grenzenlosen Irrsinns, der unangreifbar macht. Unglaublich. Aber absolut faszinierend.

      • Roland sagt:

        @“Deutscher“

        Das ist doch wohl das lächerlichste Experiment gewesen. Jeder Grundschüler weiß, daß man in jeder handvoll Luft sämtliche Verbindungen finden wird, welche chemisch möglich sind. Manchmal mehr und manchmal weniger davon. Um derartiges nachzuweisen braucht man kein Experiment.

        Was Urey nicht nachgewiesen hat ist LEBEN und dies besteht aus vielen „Buchstaben“, die funktionieren müssen!

        Das Ureyexperiment hat bestenfalls nachgewiesen, daß die Buchstaben sich bilden können. Aber in einer Druckerei liegen auch massenhaft Buchstaben herum, aber sie ordnen sich nicht zu einem sinnvollen Text an!

        Auf einer Baustelle liegt auch massenhaft alles benötigte Baumaterial zum Hausbau herum. Aber noch nie haben sich die Bausteine zu einem Haus zusammengelegt und zusammengemörtelt, wenn es ein Erdbeben gab oder einen Wirbelsturm oder nach dem Regen die Sonne schien.

        Ihr Evoluzzer deutet aber auf die Bausteine und den Mörtel und sagt, seht her, alles ist da, jetzt brauchen die sich nur noch in die richtige Reihenfolge bringen!

        Ihr Evolutionsgläubigen seid ja so primitiv, daß man euch allen Unsinn erzählen kann. Ihr glaubt ihn trotzdem!

      • Kint sagt:

        Hihi, richtig, Deutscher. Nur nicht lockerlassen. Eins wenigstens wissen wir beide: Dein Verstand ist unerreichbar.
        Weshalb ich Dir einfach nicht böse sein kann: Ich glaube, dass Du´s ernst meinst – auch wenn manche meinen mögen, dass ich da mal wieder zu blauäugig bin. Und Deine Begeisterung für Deine schöne neue Welt da oben, in Deinem Wolkenkuckucksheim, spricht für das Ausmaß Deiner Verzweiflung an der vorigen. Ist ja noch kein Schizophrener vom Himmel gefallen.
        Von daher ist auch nicht schlimm, dass Deine Selbstdiagnose falsch ist (die ich mir zuerst zu eigen gemacht habe, zugegeben). Du fühlst Dich ja gar nicht beleidigt von all den Blödsinnigen. Du genießt es einfach, aus abwegigsten Höhen jede Realität zu verhöhnen, mit jedem erstbesten Gedankenzipfel Deines verwirrten Geistes den Für-dumm-Erklärten Beweise für Deine geistige Unerreichbarkeit um die Ohren zu hauen.
        Auch ein Weg. Bloß kein neuer und auch kein seltener.
        Die Kinder staunten auch, als der gestresste Papa abends stöhnte: Kinder, war das ne Heimfahrt – NUR Geisterfahrer!

      • Skeptiker sagt:

        @Deutscher

        Es sind nur ja oder nein Antworten zulässig, ich erkläre es dir nochmal.

        Gruß Skeptiker

      • Kint sagt:

        Klar willst Du spielen. Jeden Tag, 5 x was neues. Damit Du Dir – nicht den Blöden, da korrigier ich mich gern, lerne ja noch dazu und noch dazu langsam 🙂 – 5 x am Tag sagen kannst, dass Du weit über der bösen, blöden Welt stehst, die so real wehtun kann.
        Ist gut. Kein Problem. Hab auch keine Sorge, dass Du eines Tages keinen Spielkameraden mehr findest. Auch kein Problem, dass diese Art Schizophrenie, mit Genussfaktor, für Dich existenznotwendig ist. Halt die bloß am Laufen, wenn Dir auch noch die 2. Welt platzt, sieht´s / geht´s noch schlimmer aus als jetzt schon.
        Mich beschäftigt ne ganz andere Frage. Und dabei warst Du mir bislang keine Hilfe.
        Jeder braucht mal einen Ausweg, oder eine Auszeit. Klar. Wird alles ein bisschen viel sonst. Gibt dafür die verschiedensten Möglichkeiten. Und wenn sich einer nun gleich den Verstand ausknipst, mag es sich ja auch ne Weile ganz schmerzfrei leben. So weit so gut. Aber das Aber kommt jetzt: Wie will er ihn je wieder anknipsen? Und wann? Und warum sollte er überhaupt?
        Er weiß ja nicht mehr, welche Weiche er umgestellt hat damals, als er sich auf´s Abstellgleis gefahren hat. Und warum – was so unerträglcih wehgetan hat. Weiß nicht mehr, wo das Knöpfchen ist. Weiß nciht mehr, welches das Passwort war, das er weggeschmissen hat. So stell ich mir das jedenfalls, laienhaft, vor. M. a. W. ich persönlich halte das Verrücktwerden nicht gerade für nen sehr empfehlenswerten Ausweg. Sondern für ne Einbahnstraße, und vermute, der Durchschnittsverrückte hasst nichts mehr als Bremse oder Rückwärtsgang. Nun ja. Habe keine Lösung. Aber wenigstens siehst Du daran, dass ich mich mit Dir beschäftige. Der Nächste, wenn auch in weiter Ferne, sozusagen.

      • Skeptiker sagt:

        @Kint

        Deine Antwort ist auch nicht richtig, ich erklär es Dir noch mal.

        Ab der 50 Sekunde wäre der Entsperr Code 2001 gewesen, das kann doch nicht so schwer gewesen sein.

        Ab der 50 Sekunde.

        Der Code ist nun ein Anderer, also dran bleiben.

        Entschuldigung @Kint, Du solltest nun nicht gemeint sein.

        Gruß Skeptiker

      • Kint sagt:

        “ So einfach möchte ich auch mal gestrickt sein, einfach alles ausblenden können was mir nicht in den Kram passt. Frei nach dem Motto, ich mach mir meine Welt widde widde wie sie mir gefällt.“

        Spiel weiter, Deutscher. Die Sonne scheint, der Sandkasten ruft.

  4. netzband sagt:

    Überall sägen sie an unserer Kultur, genau wie im Bolschewismus: der sowjetische Mensch sollte keine Geschichte haben, oder eine marxistische: (via terragermania.com)
    „Reiter von Südwest über Nacht abgesägt“
    http://www.az.com.na/lokales/reiter-ber-nacht-abges-gt.415079

    Das Reiterdenkmal in Windhoek ist vom Sockel vor der Alten Feste entfernt worden. Am Abend und in der Nacht des ersten Weihnachtsfeiertages wurde das Bronze-Standbild demontiert. Die Polizei hatte das Areal großräumig abgesperrt, Informationen dazu gab es nicht.
    .
    Von Stefan Fischer Windhoek

  5. netzband sagt:

    Was Weihnachten für uns Deutsche bedeutet, kann man in einem Kommentar nicht ausdrücken, aber man muß schon besorgt sein, wenn Leute, die sich für national halten unsere abendländische Kultur ablehnen oder sogar verächtlich machen. Sind jene in der kommunistischen Zone aufgewachsen oder im Westen durch ebensolche marxistischen Einflüsser der 68er ihrer Beziehung zu unserer Kultur beraubt worden, ist gleichermaßen seelische Verelendung.

  6. Deutscher sagt:

    Richtig so, religiöse Unterrichte und Feste gehören generell sowieso aus den Schulen verbannt!

    • Kint sagt:

      Das war doch Gedankenkompott? Das eine hat doch nichts mit dem andren zu tun.
      Systematisch soll die hiesige Kultur begraben werden, in allen FAcetten. Jede fremde Kultur wird überall zum Nonplusultra hochgejubelt. Nicht mal der Postbote darf mehr als Weihnachtsmann kommen, im Kindergarten sind Gummibärchen verpönt und werden islamische Feste begangen. Das ist der eine Punkt.
      (Erst) Wenn dieses Problem gelöst ist, kann man sich weiteren Fragen widmen. Wie verbogen und verlogen ist die Religion? Wie soll mit ihr umgegangen werden? Das ist ein anderes Thema. Alle Religionen raus aus allen Schulen, wie Du meinst? Das haben aber die Menschen hier zu entscheiden, nicht irgendwelche Gehirnwäscher, denen es um die Beseitigung restlicher Werte geht. Die gehören vermutlich ins Irrenhaus. Ich jedenfalls stimme ihnen NICHT zu, Deutscher.
      Erst recht können nicht Leute freie Fahrt haben, die Kirchen beschmieren oder wie im Osten geschehen gleich anzünden. Und das ist das gleiche in Grün wie im Artikel, bloß einen Gang höher geschaltet. Es ist das gleiche, ist gewünscht. Unten wird gezündelt, brennen tut´s weiter oben. So ist das nun mal.
      Wohin die Beseitigung unserer Tradition und Förderung anderer führt: Bis hin dazu, dass sog. Menschen aus Traditionsgründen oder wegen sonstiger schwachsinniger Gründe Kinder vergewaltigen, eigene oder fremde, s. Kommentar unten.
      Die gehören alle in den Knast. Und wer das verhindert, gleich mit. Und damit kommen zB Vergewaltiger und Fürsprecher besser weg, als sie erwarten dürfen. Für die empfahl jemand schon mal einen Mühlstein um den Hals in entsprechend tiefem Wasser.

      • Deutscher sagt:

        Das eine hazt sehr wohl etwas mit dem anderen zu tun. Es ist nur konsequent wenn man von der Trennung von Kirche und Staat redet das auch Weihnachtsfeiern und dergleichen aus den Schulen verschwinden.
        Wenn der Postman plötzlich als Mohammed Pakete ausliefert würden sich auch wieder die Christen aufregen, von daher ist es nur vernünftig das er gar kein Kostüm an hat. Wozu auch, er ist Postman und nicht der Weihnachtsman. Wer unbedingt seine religiösen Ansichten ausleben möchte der soll das in dem entsprechenden Gotteshaus oder zu Hause tun!

        Wer glaubt mit der Todesstrafe auch nur irgendetwas zum besseren wenden zu können, der sollte sich mal besser informieren.

      • Kint sagt:

        Hm. Frage mich, ob ich mich so undeutlich ausgedrückt habe.
        Es ist ein Riesenunterschied, ob
        – einer alle (restlichen) Traditionen und Werte eines Volkes wegwischen und andere als Errungenschaft preisen will
        – oder ob diese Traditionen in sich (hinter)fragwürdig sind.
        Der Weihnachtsmann von der Post stößt auf Unwillen von Ausländern und denen, die allem ausländischen das Wort reden. Genau die beherrschen die öffentlichen Meinungs- und Wertbestimmungen und sorgen dafür, dass in Kindergärten islamisch gefeiert wird etc. Klar soweit? – Und dem widerspreche ich.
        Und muss mich wundern, dass die Antwort diesen Punkt, den jeder sieht und der ausdrücklich angesprochen ist, so ganz außer acht lässt.
        Sich mit den eigenen Traditionen zu beschäftigen, diese möglicherweise geradezurücken, ist Sache eines Volkes, nicht fremdbestimmter Besserwisser, die allen möglichen diktatorischen Plänen nachhängen. Auch klar, oder?
        Dann frage ich mich allerdings, wozu alles falsch verstanden und alles 2x geschrieben werden soll.

        Todesstrafe: „Wer glaubt…“ Ja eben – was hab ich damit zu tun? Warum wird´s nicht gelesen, oder sondern so getan, als würde es nicht verstanden?
        Nichts für ungut – aber aus allem das Gegenteil rauszulesen, ist nicht gerade ne erfreuliche Diskussionsweise. Es erinnert mich zu sehr an Leute, die sich bewusst undeutlich ausdrücken, damit sie am Ende sagen können, gerade die abwegigste Interpretation – auf die keiner gekommen ist – gerade die hätten sie gemeint. Von Leuten, die nicht verstehen, was sie lesen, wollen wir ja nicht reden.

        Keine schlechten Tage, um mal drüber nachzudenken. Also – auf ein besseres!

      • OstPreussen sagt:

        @“Deutscher“
        Danke für diesen Kommi, Du kleine süße widerliche Kreatur-mehr Selbstoutung geht NICHT!
        GruSS an Deinen FührungsOffizier 😆 , die nächste Schulung sollte noch tiefgründiger sein…
        Ich wünsche Dir VON GANZEM HERZEN „alles“ Gute! Bein-, Hals-und Genickbruch sprichwörtlich.

      • Skeptiker sagt:

        @OstPreussen

        Diese Erscheinung ist doch auch nicht koscher@Germania2013.

        Meines Wissens mochte Dich Amita ganz gerne, aber er mit seine gehässigen Art, hat die Frau doch echt verprellt.

        Anders ausgedrückt:

        Die sind hier…auf diesen Raum

        Gruß Skeptiker

      • OstPreussen sagt:

        @Skepti
        Was’n los bei und mit Dir??? Das die Amita sich nicht mehr meldet mag schade sein, ja, aber es ist und bleibt dann Ihr ureigenster EntschluSS.
        Germania dürfte eine Frau sein und ist mindest mir-allein anhand Ihrer Meinungen-koscher.
        Wahrheiten können allerdings sehr bitter aufstoßen und schmecken nicht jedem.
        GruSS an Dich nach HH

      • Skeptiker sagt:

        @OstPreussen
        Germania dürfte eine Frau sein.

        Das es eine Frau ist konnte ich nicht feststellen.

        Dann muss die Frau eine böse Hexe sein.

        Entschuldigung.

        Ich selber sehe Frauen lieber so:

        Nichts für ungut.

        Frohe Weihnachten.

        Gruß Skeptiker

      • OstPreussen sagt:

        @Skepti
        Also ich habe das Silikon (Jordan Carver?!>Boobs<) lieber im Bad…als Fugenabdichtung!
        Germania ist ne Frau-PUNKT.
        Auch nüx für unguat!
        Frohes Julfest!
        GruSS
        OstPreussen

      • Skeptiker sagt:

        @OstPreussen

        Nee, Sie ein „Natur- Busen – Wunder“, ohne künstliche Auspolsterung.

        Ich finde sowas schön.

        Gruß Skeptiker, immer meine Weihnachtswünsche.

      • Kint sagt:

        Skeptiker hat immer recht, hier besonders. 🙂
        Schönes Fest allerseits, gern Julfest!

      • OstPreussen sagt:

        @Skepti
        So langsam schwant mir bei Deiner VorLiebe für natürlich pralle weibliche Rundungen, das Du leider wohl mit hinter FEMEN steckst 😯 🙄 .
        Das hier>
        http://de.nachrichten.yahoo.com/k-lner-dom-frau-springt-barbusig-vor-meisner-154330298.html
        war wohl dann Dein „Racheakt“ an Germania…für die „Vertreibung“ von Amita 😆 😀 !
        Beste GrüSSe, Du „Schlimmer“ 😉

      • Germania2013 sagt:

        Au weia. Ein Sexist bist du auch noch. Wird ja immer schlimmer. – Tja, Leute, die die Wahrheit nicht ertragen koennen, sollten besser nicht mit mir diskutieren.

      • Roland sagt:

        @“Deutscher“

        „Völker haben sich schon immer vermischt untereinander…“

        „Wer also jetzt meint es müsse nun der Status quo beibehalten werden der ist einfach nur rückständig, denn Austausch und Vermischung bringt eine Gesellschaft immer nur nach vorne, während Abgrenzung und Eingrenzung immer Stillstand und Tod bedeutet.“

        Beides ist falsch. Völker sind genau wegen Nichtvermischung entstanden. Jedes Volk entstammt einer mehr oder weniger langen Zeit der Inzucht aufgrund von Mangel von neuen Partnern. Völker sind also durch Degeneration der ursprünglich einen Menschenart auseinandergedriftet. Das eine Volk hat mehr oder weniger Schäden dabei zurückbehalten und diese Schäden genetisch fixiert und deshalb gibt es überhaupt Rassen.

        Rassen/Völker bildeten sich nach globalen Katastrophen, wo nur sehr wenige Menschen überlebten. Wenn eine überlebende Familie sich fortpflanzen wollte, mußte sie zwangsweise Inzucht betreiben. Dabei werden die während einer Generation entstehenden Schäden leicht genetisch fixiert und deshalb kommt es auch zu genetisch klar unterscheidbaren Völkern.

        Man darf annehmen, daß die weiße Rasse die am wenigsten geschädigte Rasse ist und daher ist heutzutage Vermischung mit anderen Rassen auf jeden Fall schädlich.

        Die letzte globale Katastrophe ist auch noch nicht lange her und dies erkennt man bereits genau an dem Umstand, daß die Rassen eben NICHT vermischt sind.

        Deine Behauptungen sind daher die eines Dummschwätzers und mit einiger Wahrscheinlichkeit entstammst du einem genetisch stark degenerierten Wüstenvolk.

      • Kint sagt:

        „die Grundlagen der modernen Evolutionstheorie nacharbeiten.“
        Das geht ja nicht, dann bleibt ja keine Theorie mehr übrig.

      • Roland sagt:

        @“Deutscher“

        Die Evolutionsreligion werde ich nicht nachbeten. Schließlich bin ich nicht so schwachsinnig wie du, der diesen Blödsinn sogar glaubt!

      • Deutscher sagt:

        Was glaubst du denn? Das Gott die Erde an 7 Tagen erschaffen hat?

      • Kint sagt:

        Das sagen viele. An irgendwas glauben muss der Mensch.
        Das Verstehen steht auf einem ganz anderen Blatt. Aber wer redet schon davon.
        Na sagen wir einfach: eine Meinung, die dem eigenen Glauben widerspricht, ist „Schwachsinn“.

        So. Kommen wir nun zur Frage des Abends: Warum unterschreiben nur so wenige den letzten Satz?

      • Deutscher sagt:

        „Na sagen wir einfach: eine Meinung, die dem eigenen Glauben widerspricht, ist “Schwachsinn”. “

        Solange man seine Meinung vernünftig begründen kann bin ich der letzte der diese als Schwachsinn abtun würde.

      • Kint sagt:

        Du warst der erste.

      • Skeptiker sagt:

        @Deutscher

        Wie schnell kann Antje sein?

        Gruß Skeptiker

      • Deutscher sagt:

        35.000 km/h, hat die NASA doch herausgefunden.

      • Kint sagt:

        Was zu befürchten war, bestätigt sich.
        Diktatorisch nenne ich, ner Gesellschaft fremdgewünschte Veränderungen aufzuzwingen.
        Doppelmoralisch, wenn nicht betrügerisch würde ich nennen, den religionsfernen Staat zu predigen, aber bloß die bestehende Tradition, Religion wegzuwischen und die Verbreitung neuer / fremder zu fördern bzw. zuzulassen. S. das Kindergarten-Beispiel. Und s. die hier ausdrücklich propagierte Vermischung.
        Hier entsteht nichts, schon gar nicht ein Volk. Hier zerbröckelt etwas, wird etwas zersetzt und reduziert. Es entsteht nichts, sondern verschwindet etwas.
        An einem Fest der Werte stört mich allein schon, dass es keine Werte definiert. Also auch fremde, unbekannte bis irre „Werte“ umfasst, bis hin zu Kinderheiraten und noch schlimmerem, wie geschildert. Was mich am Modern-„Guten“ stört? Dass es alles umfasst, auch das Schlechte. DAS stört mich dran.

      • Germania2013 sagt:

        Das Christentum gehoert eher zu Deutschland als der Islam, ist doch Deutschland schon seit vielen Jahrhunderten christlich. Den Islam will hier keiner, genauso wenig, wie jemand, der klaren Verstandes ist, will, dass sich Voelker vermischen. Das Argument, Voelker haetten sich schon immer vermischt, passt nicht zur derzeitigen, Europa aufgezwungenen Zwangskolonialisierung, um die weisse Rasse bewusst und gezielt zu vernichten Dabei handelt es sic um Voelkermord und nicht um vom Volk gewollte Vermischung.

      • Germania2013 sagt:

        Ich glaube nicht, dass ich mich mit dir ausgiebig über meine Sichtweise unterhalten werde, dazu bist du mir einerseits zu dumm, was diese deine Antwort ziemlich klar beweist, 2. verdrehst du ständig, was ich schreibe, und 3. ist mir der Dialog nicht interessant genug. Ich mag nämlich nicht mit Dummen reden. Da muss man ständig korrigieren, und wird trotzdem nicht richtig verstanden. Bringt nix. Ist Zeitverschwendung.

      • Skeptiker sagt:

        @Germania
        @Deutscher

        Ihr Seid beide so ein paar Rotzbalken, was war zu erst da?

        Die Henne oder das Ei?

        Ihr habt Euch aus zerschlagen Knochen ernährt, weil im Rückenmark war so etwas Kostbares.

        @Germa, @Deutscher, der Film ist für Euch. (Frei von Aldi Taschenrechner)

        Man kann schon sagen kostenlos.

        Gruß Skeptiker

  7. OstPreussen sagt:

    „Weihnachten“ ist doch nicht DAS Problem-dieser aufoktroiierte zum KonsumanreizSpektakel bemühte ChristenMüll gehört eh in den Orkus gespült.
    Für mich ist Wintersonnenwende und jetzt folgen die Rauhnächte!
    Problem sind und bleiben diese geistesgestörten scheinbar lobotomierten „GutmenschenHirnsteine“, die nicht mal kapieren, das Sie auch sich und Ihren Kindern den Ast absägen, auf dem Sie noch sitzen 😡 .
    Kommen wir an die nicht irgendwie bald ran, reißen Sie uns alle mit in den Abgrund 😦 .
    LG

    • Germania2013 sagt:

      Das sowieso.

    • Kint sagt:

      Stimmt. Aber das heißt noch nicht, dass man denen erlauben kann, die wenn auch verkorksten Überreste, manche nennen sie noch Grundlagen, unserer Kultur zu zertreten. Also ist auch dieser Anti-Weihnachtsmist nicht hinzunehmen.
      Wär das die Grundlage, wäre Deine Richtung und Argumentation ja OK. Deren ist es nicht.
      (Was letztlich dazu führt, dass Weihnachten, gleich die eigene Tradition, „gegen die“ zu verteidigen ist , bis man sich damit selbst auseinandersetzen kann. Klingt fast schizophren auf den ersten Blick , würd ich aber so sehen. Doppelt bescheuerte WElt, quasi, aber so ist es nun mal.)

    • Kint sagt:

      und das geht ja viel weiter.
      Nördliches Westfalen: 40 Kreuze und Statuen zerstört.
      http://www.kath.net/news/44227

      • Germania2013 sagt:

        Natürlich geht das so weiter. Bis der Michel lernt, sich zu wehren. Das kann aber noch sehr lange dauern. Bis dahin ist möglicherweise alles kaputt. Aber das ist dem Michel auch egal. Er hat ja sein Smartphone.

      • Germania2013 sagt:

        Hier ein neuer Anschlag auf die Menschlichkeit: http://www.inhr.net/artikel/unrechtsrepublik-%C3%B6sterreich-t%C3%BCrken-d%C3%BCrfen-kinder-vergewaltigen

        Aber auch das interessiert den Michel auch nicht. Er meint, er sei nicht betroffen. Sind ja nicht seine Kinde. Nun ja. Wenn dann mal im Land die Scharia herrscht, dann ist er betroffen. Dann ist es aber zu spät.

        Aber so weit kann der Michel nicht denken. Oder er weigert sich. Keine Ahnung. Mir ist Dummheit noch nie erklärbar gewesen. Ich hab aber auch kein Smartphone.

    • Ja, stimmt 100%-tig. Das Weihnachtsfest mit allem Drum & Dran wurde vom Vatikan von unsren Ahnen gestohlen und pervertiert; noch nichtmal unsre heilige Tanne liess man allein. Was auch immer schönes man beim Weihnachtsfest erkennt, es stammt von unsren Ahenen, ganz so wie die groassartigen Kathedralen & die Musik eines Bach´s & der Stollen & das Früchtebrot TROTZ, nicht wegen dem Glauben kreiert wurden. Gerry Frederics

Schreibe eine Antwort zu Kint Antwort abbrechen

Trage deine Daten unten ein oder klicke ein Icon um dich einzuloggen:

WordPress.com-Logo

Du kommentierst mit Deinem WordPress.com-Konto. Abmelden /  Ändern )

Google Foto

Du kommentierst mit Deinem Google-Konto. Abmelden /  Ändern )

Twitter-Bild

Du kommentierst mit Deinem Twitter-Konto. Abmelden /  Ändern )

Facebook-Foto

Du kommentierst mit Deinem Facebook-Konto. Abmelden /  Ändern )

Verbinde mit %s

Archiv

Zugriffe gesamt

  • 4.054.500 Zugriffe
%d Bloggern gefällt das: